Stem-loop sequence dvi-mir-9711

AccessionMI0030971 (change log)
DescriptionDrosophila virilis miR-9711 stem-loop
Stem-loop
   u   u  g   u           uuuu 
5'  cag ua caa ugaagcauuca    g
    ||| || ||| |||||||||||    c
3'  guu au guu acuuuguaagu    u
   g   c  g   c           uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9427098-9427154 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9711
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
Database links

Mature sequence dvi-miR-9711-5p

Accession MIMAT0039289
Sequence

1 - 

ucaguuagcaauugaagcauuca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9711-3p

Accession MIMAT0039290
Sequence

37 - 

aauguuucacuugguacuugg

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).