Stem-loop sequence dvi-mir-9712

AccessionMI0030972 (change log)
DescriptionDrosophila virilis miR-9712 stem-loop
Stem-loop
   -   a      c                  ccauaguuu        u 
5'  gca cgucug uacuugcuuagucguuaa         ucuuuaua a
    ||| |||||| ||||||||||||||||||         ||||||||  
3'  cgu gcggac auggaugagucggcaguu         agaaauau a
   c   c      a                  ---------        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9426825-9426912 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9712
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
Database links

Mature sequence dvi-miR-9712-5p

Accession MIMAT0039291
Sequence

15 - 

uugcuuagucguuaaccauag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9712-3p

Accession MIMAT0039292
Sequence

55 - 

aagauugacggcugaguagg

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).