Stem-loop sequence dvi-mir-9714

AccessionMI0030974 (change log)
DescriptionDrosophila virilis miR-9714 stem-loop
Stem-loop
   ---    ac     a      -     uuauaauuu 
5'    ugac  acuug ucagca ugcga         c
      ||||  ||||| |||||| |||||          
3'    acug  ugaac aguugu acgcu         c
   gau    aa     a      u     ccuaacaua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9426640-9426709 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9714
dvi-mir-9542cscaffold_12970: 9416655-9416716 [-]
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
Database links

Mature sequence dvi-miR-9714-5p

Accession MIMAT0039295
Sequence

1 - 

ugacacacuugaucagcaugcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9714-3p

Accession MIMAT0039296
Sequence

47 - 

cauuguugaacaaguaagucau

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).