Stem-loop sequence dvi-mir-9542b

AccessionMI0030977 (change log)
DescriptionDrosophila virilis miR-9542b stem-loop
Stem-loop
   ---ac    a    c        u     uu 
5'      uggc cuuu uagucaaa agugu  u
        |||| |||| |||||||| |||||  g
3'      aucg gaaa guuaguuu ucaua  u
   ccgaa    g    c        c     ua 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9418038-9418099 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9542b
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
dvi-mir-9542cscaffold_12970: 9416655-9416716 [-]
Database links

Mature sequence dvi-miR-9542b-5p

Accession MIMAT0039299
Sequence

1 - 

acuggcacuuucuagucaaau

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9542b-3p

Accession MIMAT0039300
Sequence

40 - 

uuugauugcaaagggcuaaag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).