Stem-loop sequence dvi-mir-9542e

AccessionMI0030978 (change log)
DescriptionDrosophila virilis miR-9542e stem-loop
Stem-loop
   --a    ua   c    u       cgaau 
5'    cugg  cuc guac caaagag     u
      ||||  ||| |||| |||||||     c
3'    gauc  gag cgug guuucuc     u
   cua    gg   a    c       auacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9417366-9417426 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9542e
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
dvi-mir-9542cscaffold_12970: 9416655-9416716 [-]
Database links

Mature sequence dvi-miR-9542e-5p

Accession MIMAT0039301
Sequence

1 - 

acugguacuccguacucaaag

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9542e-3p

Accession MIMAT0039302
Sequence

40 - 

uuugcgugcagagggcuagau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).