Stem-loop sequence dvi-mir-9720

AccessionMI0030985 (change log)
DescriptionDrosophila virilis miR-9720 stem-loop
Stem-loop
   ac     ca  --c   aaucuuuauaguuauau 
5'   cuacu  gc   guc                 a
     |||||  ||   |||                  
3'   gauga  cg   cag                 a
   -c     -a  aau   caauugguaucaaaaga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9426838-9426903 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9720
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
Database links

Mature sequence dvi-miR-9720-5p

Accession MIMAT0039313
Sequence

1 - 

accuacucagccgucaaucuuuau

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9720-3p

Accession MIMAT0039314
Sequence

42 - 

uaugguuaacgacuaagcaagu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).