Stem-loop sequence gma-MIR167k

AccessionMI0031050 (change log)
DescriptionGlycine max miR167k stem-loop
Literature search

26 open access papers mention gma-MIR167k
(185 sentences)

Stem-loop 
   -    u     -      g c      uaa      u  uu 
5'  cugg ugaag cugcca c ugaucu   cuuuuc cu  u
    |||| ||||| |||||| | ||||||   |||||| ||   
3'  gauc acuuc gauggu g acuaga   gaaaag ga  a
   u    c     c      - u      cua      -  uu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 307525-307604 [-]
intergenic
Database links

Mature sequence gma-miR167k

Accession MIMAT0036388
Sequence

6 -  

ugaagcugccagccugaucuua

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).