Stem-loop sequence gma-MIR9763

AccessionMI0031062 (change log)
DescriptionGlycine max miR9763 stem-loop
Literature search

1 open access papers mention gma-MIR9763
(1 sentences)

Stem-loop
   -        ca                  u       ua   a  a 
5'  uccaaacc  uccaacucugaagauaau ugguuca  guu uc a
    ||||||||  |||||||||||||||||| |||||||  ||| ||  
3'  ggguuugg  agguugagauuucuauua accaagu  caa ag g
   u        uc                  u       --   -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 6002646-6002735 [+]
intergenic
Database links

Mature sequence gma-miR9763

Accession MIMAT0036400
Sequence

6 - 

acccauccaacucugaagaua

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1