Stem-loop sequence tch-mir-98

AccessionMI0031233 (change log)
DescriptionTupaia chinensis miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u                 u    ---------       ggg 
5'    gagguaguaaguuguau guug         ugggguu   a
      ||||||||||||||||| ||||         |||||||   u
3'    uuucaucauucaacaua caau         accccag   u
   ccc                 u    agaagauua       aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB364533.1: 129591-129670 [-]
intergenic
Database links

Mature sequence tch-miR-98-5p

Accession MIMAT0036570
Sequence

1 - 

ugagguaguaaguuguauuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1