Stem-loop sequence tch-mir-99b

AccessionMI0031246 (change log)
DescriptionTupaia chinensis miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   c         ac   c    c - -   c 
5'  acccguaga  cga cuug g g ggc u
    |||||||||  ||| |||| | | |||  
3'  ugggugucu  gcu gaac c c ccg u
   -         gu   c    a a g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321018.1: 123097-123153 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-99b
tch-mir-99bKB321018.1: 123097-123153 [+]
tch-let-7eKB321018.1: 123251-123317 [+]
tch-mir-125aKB321018.1: 123734-123791 [+]
Database links

Mature sequence tch-miR-99b-5p

Accession MIMAT0036582
Sequence

1 - 

cacccguagaaccgaccuugcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1