Stem-loop sequence tch-let-7i

AccessionMI0031272 (change log)
DescriptionTupaia chinensis let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u                 u   --------  u     ugu 
5'    gagguaguaguuugugc guu        gg cgggu   g
      ||||||||||||||||| |||        || |||||   a
3'    uuccgucaucgaacgcg caa        uc gcccg   c
   ucg                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320844.1: 2054204-2054281 [-]
intergenic
Database links

Mature sequence tch-let-7i-5p

Accession MIMAT0036604
Sequence

1 - 

ugagguaguaguuugugcuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1