Stem-loop sequence oha-mir-98

AccessionMI0031494 (change log)
DescriptionOphiophagus hannah miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   cuucuugcucc   -     u                 u    ---------       g g 
5'            uac caggg gagguaguaaguuguau guug         uggggua g a
              ||| ||||| ||||||||||||||||| ||||         ||||||| |  
3'            gug guccc uuucaucauucaacaua caau         accccgu u u
   -----------   c     -                 u    agagacuaa       g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000045.1: 599246-599349 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-98
oha-let-7f-1AZIM01000045.1: 598820-598907 [+]
oha-mir-98AZIM01000045.1: 599246-599349 [+]
Database links

Mature sequence oha-miR-98-5p

Accession MIMAT0036962
Sequence

20 - 

ugagguaguaaguuguauuguu

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-98-3p

Accession MIMAT0036963
Sequence

75 - 

aacuauacaacuuacuacuu

 - 94

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).