Stem-loop sequence ata-MIR5070

AccessionMI0031651 (change log)
DescriptionAegilops tauschii miR5070 stem-loop
Gene family MIPF0002013; MIR5070
Stem-loop
   a  uaa                  u           ca   a      u  u 
5'  cc   aggguaccuucugacccu cuuaguucaac  aau aacuaa uu u
    ||   |||||||||||||||||| |||||||||||  ||| |||||| || c
3'  gg   ucccaugggaggcuggga gaaucaaguug  uua uugauu aa c
   a  ---                  u           ac   c      u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 1380924-1381027 [+]
intergenic
Database links

Mature sequence ata-miR5070-5p

Accession MIMAT0037098
Sequence

16 - 

ucugacccuucuuaguucaac

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5070-3p

Accession MIMAT0037099
Sequence

73 - 

uugaacuaaguagggucggag

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).