Stem-loop sequence ata-MIR171c

AccessionMI0031652 (change log)
DescriptionAegilops tauschii miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   ag     ugaa    --       ug          ag  a cu  u     agg 
5'   gggag    cgcg  guauugg  cgguucaauc  ag g  gg gcccc   a
     |||||    ||||  |||||||  ||||||||||  || |  || |||||   g
3'   cucuu    gcgc  uauaacc  gccgaguuag  uc c  cc ugggg   g
   --     --ug    ac       gu          cu  - cu  u     aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 484289195-484289300 [-]
intergenic
Database links

Mature sequence ata-miR171c-5p

Accession MIMAT0037100
Sequence

14 - 

cgguauuggugcgguucaauc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR171c-3p

Accession MIMAT0037101
Sequence

77 - 

uugagccgugccaauaucacg

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).