Stem-loop sequence ata-MIR395e

AccessionMI0031661 (change log)
DescriptionAegilops tauschii miR395e stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   --c      u         a             -a      au 
5'    uuaccg ggguuccuu caagcacuucacg  ggcauu  u
      |||||| ||||||||| |||||||||||||  ||||||   
3'    aguggu cucaagggg guuugugaagugu  ccguaa  a
   cgu      u         -             ca      ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 522813143-522813226 [-]
intergenic
Database links

Mature sequence ata-miR395e-5p

Accession MIMAT0037116
Sequence

11 - 

guuccuuacaagcacuucacg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR395e-3p

Accession MIMAT0037117
Sequence

55 - 

ugaaguguuugggggaacuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).