Stem-loop sequence ata-MIR172b

AccessionMI0031677 (change log)
DescriptionAegilops tauschii miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention ata-MIR172b
(2 sentences)

Stem-loop
   --u     a         c  c        a    ----  auc       a  uc 
5'    cuugc ggugcagca ca caagauuc cauc    gg   cgucgua aa  a
      ||||| ||||||||| || |||||||| ||||    ||   ||||||| ||   
3'    ggacg cuacgucgu gu guucuaag guag    cc   gcagcgu uu  a
   cac     a         a  a        a    ugga  -gc       a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 363849505-363849611 [-]
intergenic
Database links

Mature sequence ata-miR172b-5p

Accession MIMAT0037148
Sequence

11 - 

gcagcaccaccaagauucaca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR172b-3p

Accession MIMAT0037149
Sequence

77 - 

agaaucuugaugaugcugcau

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).