Stem-loop sequence ata-MIR168

AccessionMI0031679 (change log)
DescriptionAegilops tauschii miR168 stem-loop
Gene family MIPF0000081; MIR168
Stem-loop
   --  c   g gc             au     c  uca     cc 
5'   cg cuc g  ucgcuuggugcag  cggga cc   gcccg  c
     || ||| |  |||||||||||||  ||||| ||   |||||   
3'   gc gag c  agugaaccacguu  gcccu gg   cgggc  c
   cg  c   g ua             cc     a  --c     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 52832588-52832675 [+]
intergenic
Database links

Mature sequence ata-miR168-5p

Accession MIMAT0037152
Sequence

11 - 

ucgcuuggugcagaucgggac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR168-3p

Accession MIMAT0037153
Sequence

58 - 

cccgccuugcaccaagugaau

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).