Stem-loop sequence ata-MIR395f

AccessionMI0031695 (change log)
DescriptionAegilops tauschii miR395f stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   --cu  u            u               -  aucuc 
5'     cg cgggaguucccu caagcacuucaggaa gc     u
       || |||||||||||| ||||||||||||||| ||      
3'     gu guucucaagggg guuugugaagucuuu cg     u
   cgcu  u            -               a  gaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 456626944-456627027 [-]
intergenic
Database links

Mature sequence ata-miR395f-5p

Accession MIMAT0037184
Sequence

11 - 

guucccuucaagcacuucagg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR395f-3p

Accession MIMAT0037185
Sequence

55 - 

ugaaguguuugggggaacuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).