Stem-loop sequence ata-MIR9783

AccessionMI0031726 (change log)
DescriptionAegilops tauschii miR9783 stem-loop
Gene family MIPF0001947; MIR9783
Stem-loop
   a     aa          a      ac  c     c      ag      cca 
5'  aaccg  uuuuuuuuga gcacug  gc uauuu uauagg  agacgc   a
    |||||  |||||||||| ||||||  || ||||| ||||||  ||||||    
3'  uuggu  gaaaggaauu cguggc  cg auaaa auauuc  ucugcg   u
   -     cc          -      ca  a     c      cg      aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 388404643-388404748 [+]
intergenic
Database links

Mature sequence ata-miR9783-5p

Accession MIMAT0037246
Sequence

14 - 

uuugaagcacugacgccuauuucu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9783-3p

Accession MIMAT0037247
Sequence

76 - 

auaagcaccggugcuuaagga

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).