Stem-loop sequence ata-MIR5084

AccessionMI0031730 (change log)
DescriptionAegilops tauschii miR5084 stem-loop
Gene family MIPF0002026; MIR5084
Stem-loop
   a  c     ag        a          c      cu    --cac  cc       ac 
5'  ga ggguu  gauccucu caguacugua ggugcu  uagu     ug  auguggg  c
    || |||||  |||||||| |||||||||| ||||||  ||||     ||  |||||||  u
3'  cu cccaa  cuaggaga gucauggcau ccacga  auca     ac  uacaccc  g
   -  c     cu        c          a      -c    caccu  ua       cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
AOCO02019250.1: 1986563-1986683 [-]
intergenic
Database links

Mature sequence ata-miR5084-5p

Accession MIMAT0037254
Sequence

13 - 

auccucuacaguacuguacggugc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5084-3p

Accession MIMAT0037255
Sequence

89 - 

accauacgguacugcagaggauc

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).