Stem-loop sequence lja-MIR395

AccessionMI0035921 (change log)
DescriptionLotus japonicus miR395 stem-loop
Literature search

1 open access papers mention lja-MIR395
(6 sentences)

Stem-loop
       a    g          ca    c    a       ga  a 
5' ggug uucc agaguucccc  aaca uuca uaaggac  ag a
   |||| |||| ||||||||||  |||| |||| |||||||  || a
3' ccac gagg ucucaagggg  uugu aagu auuccug  uc a
       -    a          ag    c    a       ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr2: 21280798-21280887 [+]
intergenic
Database links

Mature sequence lja-miR395-3p

Accession MIMAT0043943
Sequence

64 - 

acuguugaggggaacucuaggagc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).