Stem-loop sequence ssc-mir-33b

AccessionMI0036557 (change log)
DescriptionSus scrofa miR-33b stem-loop
Literature search

3 open access papers mention ssc-mir-33b
(8 sentences)

Stem-loop
   ---------c    -   c   c  -          uu         g  u 
5'           gggc ggc ccg gg ugcauugcug  gcauugcac ug g
             |||| ||| ||| || ||||||||||  ||||||||| || a
3'           cccg ccg ggc cc acgugacggc  cgugacgug gc g
   agccacgguc    g   a   -  g          uc         g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-33b-5p

Accession MIMAT0044654
Sequence

15 - 

gugcauugcuguugcauugc

 - 34

Get sequence
Evidence not experimental

Mature sequence ssc-miR-33b-3p

Accession MIMAT0044655
Sequence

51 - 

cagugccucggcagugcagccc

 - 72

Get sequence
Evidence not experimental

References

1
PMID:24398549 "MicroRNA-33b downregulates the differentiation and development of porcine preadipocytes" Taniguchi M, Nakajima I, Chikuni K, Kojima M, Awata T, Mikawa S Mol Biol Rep. 41:1081-1090(2014).