Stem-loop sequence fhe-mir-125a

AccessionMI0037125 (change log)
DescriptionFasciola hepatica miR-125a stem-loop
Literature search

1 open access papers mention fhe-mir-125a
(1 sentences)

Stem-loop
   -uc         c          ---------c     g 
5'    ccugagacc uagaguuucc          agcuu u
      ||||||||| ||||||||||          |||||  
3'    ggacuuugg aucuuaaagg          ucgaa c
   auu         u          caacuugcac     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold514: 32449-32518 [-]
intergenic
Database links

Mature sequence fhe-miR-125a

Accession MIMAT0045223
Sequence

1 - 

ucccugagacccuagaguuuc

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).