Stem-loop sequence cel-mir-63

AccessionMI0000034 (change log)
DescriptionCaenorhabditis elegans miR-63 stem-loop
Gene family MIPF0000823; mir-63
Literature search

4 open access papers mention cel-mir-63
(5 sentences)

Stem-loop
   -ucaa    c   --   a             --    a     --c     agc 
5'      caag aga  cac auuucuaacucgu  cggu gucau   guucu   u
        |||| |||  ||| |||||||||||||  |||| |||||   |||||    
3'      guuc ucu  gug uaaagguugagcg  guca cagua   cagga   g
   aacga    a   ug   a             aa    -     uca     aaa 
Get sequence
Deep sequencing
354919 reads, 1.36e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 17598765-17598868 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-63
cel-mir-2217b-1chrX: 17608227-17608288 [+]
cel-mir-63chrX: 17598765-17598868 [-]
Database links

Mature sequence cel-miR-63-5p

Accession MIMAT0015104
Previous IDscel-miR-63*
Sequence

20 - 

ucuaacucgucgguagucaucgu

 - 42

Get sequence
Deep sequencing59787 reads, 16 experiments
Evidence experimental; CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-63-3p

Accession MIMAT0000035
Previous IDscel-miR-63
Sequence

61 - 

uaugacacugaagcgaguuggaaa

 - 84

Get sequence
Deep sequencing295122 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).