Stem-loop sequence cel-mir-65

AccessionMI0000036 (change log)
DescriptionCaenorhabditis elegans miR-65 stem-loop
Gene family MIPF0000295; mir-64
Stem-loop
   ----        --uu      u    a     aa     a c   cac  u 
5'     auggagcc    cgccga uaug cacug  gcgua c gaa   ca a
       ||||||||    |||||| |||| |||||  ||||| | |||   || u
3'     uaccucgg    gcggcu guac gugac  cgcau g cuu   gu u
   aaau        uugc      c    c     -g     c u   aga  u 
Get sequence
Deep sequencing
2584784 reads, 1.32e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 2173002-2173101 [+]
sense
Y48G9A.3 ; Y48G9A.3; intron 11
Clustered miRNAs
< 10kb from cel-mir-65
cel-mir-229chrIII: 2172452-2172566 [+]
cel-mir-64chrIII: 2172848-2172957 [+]
cel-mir-65chrIII: 2173002-2173101 [+]
cel-mir-66chrIII: 2173108-2173206 [+]
Database links

Mature sequence cel-miR-65-5p

Accession MIMAT0000037
Previous IDscel-miR-65
Sequence

18 - 

uaugacacugaagcguaaccgaa

 - 40

Get sequence
Deep sequencing2583720 reads, 17 experiments
Evidence experimental; Northern [1], cloned [2-3], 454 [4], Illumina [5], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-65-3p

Accession MIMAT0015106
Previous IDscel-miR-65*
Sequence

58 - 

cugcuacgcgcagugccaugc

 - 78

Get sequence
Deep sequencing1057 reads, 17 experiments
Evidence experimental; CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).