Stem-loop sequence dme-mir-313

AccessionMI0000425 (change log)
DescriptionDrosophila melanogaster miR-313 stem-loop
Gene family MIPF0000566; mir-310
Literature search

6 open access papers mention dme-mir-313
(19 sentences)

Stem-loop
         -u    c   u  gg        ----   u 
5' auuuuc  gcug gga gg  gcaguacu    guu u
   ||||||  |||| ||| ||  ||||||||    ||| u
3' uaaaag  cgac cuu uc  cguuauga    caa u
         cc    a   u  -a        guua   u 
Get sequence
Deep sequencing
18462 reads, 1.06e+03 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-313 was predicted based on conservation of clustering with miR-310 (MI0000422), miR-311 (MI0000423) and miR-312 (MI0000424). Its expression has not been verified.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20584190-20584260 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-313
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-313-5p

Accession MIMAT0020839
Sequence

7 - 

ugcugcggaugggggcaguacu

 - 28

Get sequence
Deep sequencing15493 reads, 43 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-313-3p

Accession MIMAT0000405
Previous IDsdme-miR-313
Sequence

46 - 

uauugcacuuuucacagcccga

 - 67

Get sequence
Deep sequencing2967 reads, 45 experiments
Evidence experimental; 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).