Stem-loop sequence cbr-mir-46

AccessionMI0000500 (change log)
DescriptionCaenorhabditis briggsae miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   g    a  ag g ag           -cg     u      uc  uug 
5'  agau ca  u a  cugaagagagc   ucuau gacagu  gc   u
    |||| ||  | |  |||||||||||   ||||| ||||||  ||   u
3'  ucua gu  a u  gacuucucucg   aggua cugucg  ug   u
   a    a  cu g -a           cug     -      --  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 5569417-5569510 [-]
intergenic
Database links

Mature sequence cbr-miR-46

Accession MIMAT0000471
Sequence

58 - 

ugucauggagucgcucucuuca

 - 79

Get sequence
Evidence by similarity; MI0000017

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).