Stem-loop sequence dps-mir-92a

AccessionMI0001320 (change log)
DescriptionDrosophila pseudoobscura miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -------aua   a           a     -     u   c    uaaau 
5'           gag uugcccguagg cggga aggug caa guuu     u
             ||| ||||||||||| ||||| ||||| ||| ||||      
3'           uuc ggcggguaucc gcccu uucac guu caaa     u
   acacauacug   -           g     g     -   a    caagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 23635276-23635369 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-92a
dps-mir-92a2: 23635276-23635369 [-]
dps-mir-92b2: 23630760-23630859 [-]
Database links

Mature sequence dps-miR-92a

Accession MIMAT0001226
Sequence

54 - 

cauugcacuugucccggccuau

 - 75

Get sequence
Evidence by similarity; MI0000357, MI0000357