Stem-loop sequence ame-mir-305

AccessionMI0001591 (change log)
DescriptionApis mellifera miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

2 open access papers mention ame-mir-305
(4 sentences)

Stem-loop
     a   --u -     u     ua     u        cu    aa 
5' gg ggc   g caugu aauug  cuuca caggugcu  ggug  c
   || |||   | ||||| |||||  ||||| ||||||||  ||||  u
3' uc ccg   c guaua uuaac  gaggu guccacgg  ccau  c
     -   ugu a     c     gc     u        -c    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 10532413-10532502 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-305
ame-mir-275CM000060.5: 10532636-10532735 [-]
ame-mir-305CM000060.5: 10532413-10532502 [-]
Database links

Mature sequence ame-miR-305-5p

Accession MIMAT0001486
Sequence

16 - 

auuguacuucaucaggugcucug

 - 38

Get sequence
Evidence experimental; array [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).