Stem-loop sequence aga-mir-92b

AccessionMI0001633 (change log)
DescriptionAnopheles gambiae miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention aga-mir-92b
(19 sentences)

Stem-loop
       -ucc  a      a  u          uu     - ugau 
5' gggc    gg uguagg cg gacaggugca  auuug c    u
   ||||    || |||||| || ||||||||||  ||||| |    u
3' cccg    uc acgucc gc cuguucacgu  uaaac g    u
       ccau  g      g  c          --     u uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 39200608-39200694 [+]
intergenic
Database links

Mature sequence aga-miR-92b

Accession MIMAT0001528
Sequence

54 - 

aauugcacuugucccggccugc

 - 75

Get sequence
Evidence by similarity; MI0000379