Stem-loop sequence ptr-mir-143

AccessionMI0002549 (change log)
DescriptionPan troglodytes miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

1 open access papers mention ptr-mir-143
(1 sentences)

Stem-loop
   -gc    cgcccug    c ag      g         g      u  -  ag 
5'    gcag       ucuc c  ccugag ugcagugcu caucuc gg uc  u
      ||||       |||| |  |||||| ||||||||| |||||| || ||   
3'    cguc       agag g  ggacuc augucacga guagag cu ag  u
   cga    uuuuuga    a aa      g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr5: 149628986-149629091 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-143
ptr-mir-143chr5: 149628986-149629091 [+]
ptr-mir-145chr5: 149630713-149630800 [+]
Database links

Mature sequence ptr-miR-143

Accession MIMAT0002257
Sequence

61 - 

ugagaugaagcacuguagcuca

 - 82

Get sequence
Evidence by similarity; MI0000459
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).