Stem-loop sequence mml-mir-25

AccessionMI0003075 (change log)
DescriptionMacaca mulatta miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention mml-mir-25
(30 sentences)

Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Deep sequencing
41695 reads, 422 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 125614974-125615057 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-25
mml-mir-106bchr3: 125615402-125615483 [-]
mml-mir-93chr3: 125615179-125615258 [-]
mml-mir-25chr3: 125614974-125615057 [-]
Database links

Mature sequence mml-miR-25

Accession MIMAT0002774
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing41633 reads, 9 experiments
Evidence by similarity; MI0000082
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).