Stem-loop sequence dre-mir-731

AccessionMI0004776 (change log)
DescriptionDanio rerio miR-731 stem-loop
Gene family MIPF0001354; mir-731
Literature search

1 open access papers mention dre-mir-731
(7 sentences)

Stem-loop
   u     ug    -  aa       uuuuc      auc  ca    u 
5'  gaugc  aucu gg  ugacacg     ucccgg   gc  gaaa a
    |||||  |||| ||  |||||||     ||||||   ||  ||||  
3'  cuacg  uaga cc  acugugc     agggcc   cg  cuuu u
   a     gu    a  -g       -uuca      -ac  --    g 
Get sequence
Deep sequencing
137259 reads, 8.38e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 26082534-26082623 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-731
dre-mir-462chr8: 26082308-26082409 [+]
dre-mir-731chr8: 26082534-26082623 [+]
Database links

Mature sequence dre-miR-731

Accession MIMAT0003761
Sequence

15 - 

aaugacacguuuucucccggaucg

 - 38

Get sequence
Deep sequencing136645 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).