Stem-loop sequence sme-mir-92

AccessionMI0005156 (change log)
DescriptionSchmidtea mediterranea miR-92 stem-loop
Literature search

1 open access papers mention sme-mir-92
(2 sentences)

Stem-loop
   -     cuaa       a  u         g    --c   ug 
5'  aauug    augguaa ua cuagugcaa ucua   agg  a
    |||||    ||||||| || ||||||||| ||||   |||   
3'  uuaac    uacuauu au gaucacguu agau   ucu  a
   u     auac       a  u         -    uuu   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig5274: 27363-27446 [+]
intergenic
Database links

Mature sequence sme-miR-92-5p

Accession MIMAT0012111
Previous IDssme-miR-92*
Sequence

11 - 

ugguaaauaucuagugcaaguc

 - 32

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-92-3p

Accession MIMAT0003991
Previous IDssme-miR-92
Sequence

53 - 

gauugcacuaguuaauuauc

 - 72

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).