Stem-loop sequence mdo-mir-32

AccessionMI0005279 (change log)
DescriptionMonodelphis domestica miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
   g       ug     u            -guu  c 
5'  gagauau  cacau acuaaguugcau    gu a
    |||||||  ||||| ||||||||||||    ||  
3'  uuuuaua  gugua ugauuuaacgug    cg c
   -       gu     -            auuu  g 
Get sequence
Deep sequencing
1394 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 135714003-135714071 [+]
sense
ENSMODT00000016000 ; TMEM245-201; intron 14
Database links

Mature sequence mdo-miR-32-5p

Accession MIMAT0004095
Sequence

6 - 

uauugcacauuacuaaguugc

 - 26

Get sequence
Deep sequencing1345 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-32-3p

Accession MIMAT0026654
Sequence

48 - 

aauuuaguaugugugauauu

 - 67

Get sequence
Deep sequencing48 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).