Stem-loop sequence mdo-mir-25

AccessionMI0005370 (change log)
DescriptionMonodelphis domestica miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   g     ug   ag    g     uu g     u   g acu 
5'  gccag  uug  aggc gagac  g gcaau gcu a   c
    |||||  |||  |||| |||||  | ||||| ||| |   u
3'  cgguc  gac  ucug cucug  c cguua cgg u   g
   -     gu   ag    g     uu a     -   g ccc 
Get sequence
Deep sequencing
10949 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 257690280-257690362 [+]
sense
ENSMODT00000005328 ; MCM7-201; intron 13
ENSMODT00000042937 ; MCM7-202; intron 14
Clustered miRNAs
< 10kb from mdo-mir-25
mdo-mir-93chr2: 257689983-257690071 [+]
mdo-mir-25chr2: 257690280-257690362 [+]
Database links

Mature sequence mdo-miR-25

Accession MIMAT0004179
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing10940 reads, 5 experiments
Evidence by similarity; MI0000082
Predicted targets

References

1