Stem-loop sequence rrv-miR-rR1-2

AccessionMI0005719 (change log)
DescriptionRhesus monkey rhadinovirus miR-rR1-2 stem-loop
Stem-loop
        u   -g     a   u     cc       ---   g 
5' cagcc ccc  cgacc ugc gcgcc  guauucg   ugc g
   ||||| |||  ||||| ||| |||||  |||||||   ||| a
3' guugg ggg  guugg acg cgcgg  uauaagc   acg a
        c   ag     c   u     ca       uua   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:AF210726.1) Overlapping transcripts
AF210726.1: 114328-114410 [-]
intergenic
Clustered miRNAs
< 10kb from rrv-miR-rR1-2
rrv-miR-rR1-1AF210726.1: 116303-116380 [-]
rrv-miR-rR1-2AF210726.1: 114328-114410 [-]
rrv-miR-rR1-3AF210726.1: 112664-112767 [-]
rrv-miR-rR1-4AF210726.1: 112235-112330 [-]
rrv-miR-rR1-5AF210726.1: 111474-111557 [-]
rrv-miR-rR1-6AF210726.1: 111174-111245 [-]
rrv-miR-rR1-7AF210726.1: 111055-111132 [-]
Database links

Mature sequence rrv-miR-rR1-2

Accession MIMAT0004408
Sequence

54 - 

auacggcgcugcacgguugga

 - 74

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17451774 "Cloning and analysis of microRNAs encoded by the primate gamma-herpesvirus rhesus monkey rhadinovirus" Schafer A, Cai X, Bilello JP, Desrosiers RC, Cullen BR Virology. 364:21-27(2007).