Stem-loop sequence mcmv-mir-m21-1

AccessionMI0006250 (change log)
DescriptionMouse cytomegalovirus miR-m21-1 stem-loop
Gene family MIPF0000453; mir-m21-1
Stem-loop
       c      c  a g    c    ------------   a 
5' cccc gcuuga cg g cccc aucg            ugc c
   |||| |||||| || | |||| ||||            |||  
3' gggg cgaacu gc c gggg uagc            acg a
       c      u  a a    a    caccaucaaaug   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m21-1

Accession MIMAT0005540
Sequence

51 - 

auaggggacacguucaagccg

 - 71

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).