Stem-loop sequence cin-mir-92a

AccessionMI0007160 (change log)
DescriptionCiona intestinalis miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention cin-mir-92a
(1 sentences)

Stem-loop
   gaagcuuuagugaaguuugauua          gac      u     a   cg   ga 
5'                        uauauuacuc   ggcugg acaag gca  auc  u
                          ||||||||||   |||||| ||||| |||  |||   
3'                        auaugguggg   cuggcc uguuc cgu  uag  u
   -------------------aaaa          auu      c     a   ua   ga 
Get sequence
Deep sequencing
2320 reads, 750 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Norden-Krichmar et al refer to this sequence as mir-25 [1].

Genome context
Coordinates (JGI2) Overlapping transcripts
3p: 1864426-1864526 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-92a
cin-mir-92a3p: 1864426-1864526 [+]
cin-mir-92d3p: 1864796-1864851 [+]
cin-mir-92c3p: 1865219-1865319 [+]
Database links

Mature sequence cin-miR-92a-5p

Accession MIMAT0015253
Previous IDscin-miR-92a*
Sequence

36 - 

cggcugguacaagagcacga

 - 55

Get sequence
Deep sequencing102 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence cin-miR-92a-3p

Accession MIMAT0006096
Previous IDscin-miR-92a
Sequence

66 - 

uauugcacuugucccggucuu

 - 86

Get sequence
Deep sequencing2216 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3