Stem-loop sequence mml-mir-425

AccessionMI0007741 (change log)
DescriptionMacaca mulatta miR-425 stem-loop
Gene family MIPF0000242; mir-425
Literature search

1 open access papers mention mml-mir-425
(1 sentences)

Stem-loop
        c  u    aau        cacucccguugagugggc 
5' gaaag gc uugg   gacacgau                  c
   ||||| || ||||   ||||||||                  c
3' cuuuc cg gacc   cugugcug                  c
        u  u    cgc        uaagggcuaccgaagagc 
Get sequence
Deep sequencing
60519 reads, 333 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 93359182-93359268 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-425
mml-mir-191chr2: 93358708-93358799 [+]
mml-mir-425chr2: 93359182-93359268 [+]
Database links

Mature sequence mml-miR-425

Accession MIMAT0006324
Sequence

14 - 

aaugacacgaucacucccguuga

 - 36

Get sequence
Deep sequencing53850 reads, 9 experiments
Evidence by similarity; MI0001448
Database links
Predicted targets

References

1