Stem-loop sequence cfa-mir-92a-1

AccessionMI0008055 (change log)
DescriptionCanis familiaris miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --          c   u           uu 
5'   agguugggau ggu gcaaugcugug  u
     |||||||||| ||| |||||||||||   
3'   uccggcccug uca cguuaugguau  c
   ug          u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr22: 42478714-42478772 [+]
sense
ENSCAFT00000032612 ; cfa-mir-92a-1-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-92a-1
cfa-mir-17chr22: 42478013-42478071 [+]
cfa-mir-18achr22: 42478138-42478229 [+]
cfa-mir-19achr22: 42478298-42478355 [+]
cfa-mir-20achr22: 42478462-42478520 [+]
cfa-mir-19b-1chr22: 42478598-42478656 [+]
cfa-mir-92a-1chr22: 42478714-42478772 [+]
Database links

Mature sequence cfa-miR-92a

Accession MIMAT0006653
Sequence

38 - 

uauugcacuugucccggccugu

 - 59

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).