Stem-loop sequence cfa-mir-574

AccessionMI0008080 (change log)
DescriptionCanis familiaris miR-574 stem-loop
Gene family MIPF0000419; mir-574
Stem-loop
   uga u                 ug  gc 
5'    g gugugugugugagugug  uc  u
      | |||||||||||||||||  ||   
3'    c cacacacguacucgcac  gg  c
   aca c                 cu  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr3: 73494062-73494119 [-]
sense
ENSCAFT00000025658 ; FAM114A1-201; intron 1
Database links

Mature sequence cfa-miR-574

Accession MIMAT0006673
Sequence

37 - 

cacgcucaugcacacacccaca

 - 58

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).