Stem-loop sequence cfa-mir-25

AccessionMI0008111 (change log)
DescriptionCanis familiaris miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --    g     uu g     -   u  ac 
5'   aggc gagac  g gcaau ugc gg  g
     |||| |||||  | ||||| ||| ||   
3'   ucug cucug  c cguua gcg cc  c
   ag    g     uu a     c   c  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr6: 9498993-9499051 [+]
sense
ENSCAFT00000023450 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from cfa-mir-25
cfa-mir-106bchr6: 9498558-9498616 [+]
cfa-mir-93chr6: 9498780-9498840 [+]
cfa-mir-25chr6: 9498993-9499051 [+]
Database links

Mature sequence cfa-miR-25

Accession MIMAT0006697
Sequence

38 - 

cauugcacuugucucggucuga

 - 59

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).