Stem-loop sequence oan-mir-363

AccessionMI0006698 (change log)
DescriptionOrnithorhynchus anatinus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
          u   gu         ca  a         ga  aguu 
5' guuuugc guu  cggguggau  cg ugcaauuuu  uu    u
   ||||||| |||  |||||||||  || |||||||||  ||     
3' caggacg caa  gucuaccua  gc acguuaaaa  ag    a
          c   au         ug  -         ag  gaug 
Get sequence
Deep sequencing
46872 reads, 860 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
6: 8561848-8561936 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-363
oan-mir-1066: 8561054-8561167 [+]
oan-mir-186: 8561213-8561342 [+]
oan-mir-20b6: 8561429-8561534 [+]
oan-mir-19b-16: 8561559-8561661 [+]
oan-mir-92a-16: 8561691-8561810 [+]
oan-mir-3636: 8561848-8561936 [+]
Database links

Mature sequence oan-miR-363-5p

Accession MIMAT0006859
Previous IDsoan-miR-363*
Sequence

14 - 

cggguggaucacgaugcaauuu

 - 35

Get sequence
Deep sequencing1497 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-363-3p

Accession MIMAT0006860
Previous IDsoan-miR-363
Sequence

57 - 

aauugcacgguauccaucugu

 - 77

Get sequence
Deep sequencing45368 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).