Stem-loop sequence oan-mir-1343

AccessionMI0006708 (change log)
DescriptionOrnithorhynchus anatinus miR-1343 stem-loop
Stem-loop
               ac  a c      cg    gagc 
5' gccggggagggg  cg c cccagu  cccg    c
   ||||||||||||  || | ||||||  ||||    g
3' cggccccucccu  gc g gggucg  gggc    a
               -a  a a      --    aaag 
Get sequence
Deep sequencing
396 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig1085: 185766-185835 [-]
intergenic
Database links

Mature sequence oan-miR-1343-5p

Accession MIMAT0006874
Previous IDsoan-miR-1343
Sequence

7 - 

gaggggaccgacccccagucgc

 - 28

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1343-3p

Accession MIMAT0006875
Previous IDsoan-miR-1343*
Sequence

45 - 

gggcugggagacgaucccu

 - 63

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).