Stem-loop sequence oan-mir-92b

AccessionMI0006732 (change log)
DescriptionOrnithorhynchus anatinus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ucaaa     g  aaag   aacccc    uau            c    ga       uuu 
5'      agcca ga    uca      uuuc   gcagguugggau agug  aaugcug   g
        ||||| ||    |||      ||||   |||||||||||| ||||  |||||||    
3'      ucggu uu    agu      agag   uguccgacccug ucac  uuauggu   c
   ---ag     g  -aga   --cauu    --u            u    -g       uuc 
Get sequence
Deep sequencing
52256 reads, 880 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig159206: 733-849 [-]
intergenic
Database links

Mature sequence oan-miR-92b

Accession MIMAT0006918
Sequence

71 - 

uauugcacuugucccagccugu

 - 92

Get sequence
Deep sequencing52250 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).