Stem-loop sequence oan-mir-1421ab-1

AccessionMI0006943 (change log)
DescriptionOrnithorhynchus anatinus miR-1421ab-1 stem-loop
Gene family MIPF0000564; mir-1421
Stem-loop
               c    c     ga  gaug 
5' gugaggagcuca acgu uugca  gu    u
   |||||||||||| |||| |||||  ||    c
3' cauuccucgagu ugcg aacgu  ua    a
               c    u     ag  aaau 
Get sequence
Deep sequencing
9992 reads, 3.04e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 44298540-44298604 [-]
antisense
Clustered miRNAs
< 10kb from oan-mir-1421ab-1
oan-mir-1421ac-2X1: 44308437-44308523 [-]
oan-mir-1414X1: 44306726-44306812 [-]
oan-mir-1419c-3X1: 44304901-44305008 [-]
oan-mir-1421ag-2X1: 44303617-44303684 [-]
oan-mir-1421y-3X1: 44303056-44303140 [-]
oan-mir-1421aiX1: 44301501-44301574 [-]
oan-mir-1421ab-1X1: 44298540-44298604 [-]
oan-mir-1419dX1: 44298117-44298229 [-]
oan-mir-1419c-2X1: 44296776-44296886 [-]
oan-mir-1421ag-1X1: 44295490-44295574 [-]
oan-mir-1421y-2X1: 44294920-44295029 [-]
oan-mir-1421ab-2X1: 44293810-44293911 [-]
oan-mir-1421aaX1: 44291691-44291783 [-]
oan-mir-1419c-1X1: 44291006-44291114 [-]
oan-mir-1421zX1: 44289986-44290072 [-]
Database links

Mature sequence oan-miR-1421ab-5p

Accession MIMAT0007251
Previous IDsoan-miR-1421ab
Sequence

4 - 

aggagcucacacgucuugcaga

 - 25

Get sequence
Deep sequencing18628 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1421ab-3p

Accession MIMAT0007252
Previous IDsoan-miR-1421ab*
Sequence

43 - 

ugcaaugcgucugagcuccuu

 - 63

Get sequence
Deep sequencing678 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).