Stem-loop sequence gga-mir-1577

AccessionMI0007303 (change log)
DescriptionGallus gallus miR-1577 stem-loop
Stem-loop
        ---------      cg     cu      cuu       uc 
5' augcu         uucucc  uuucc  ucucug   uuugcuu  u
   |||||         ||||||  |||||  ||||||   |||||||   
3' uacga         aagagg  gaagg  ggggac   aaauggg  g
        ucgagacuu      au     -u      -uc       uu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 5463993-5464077 [+]
sense
ENSGALT00000043343 ; HES6-201; intron 1
Database links

Mature sequence gga-miR-1577

Accession MIMAT0007438
Sequence

50 - 

cucagggguggaaguaggagaa

 - 71

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).