Stem-loop sequence ptr-mir-425

AccessionMI0008665 (change log)
DescriptionPan troglodytes miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   -gaa      uu  aau        cacucccguugagugggc 
5'     agcgcu  gg   gacacgau                  a
       ||||||  ||   ||||||||                  c
3'     ucguga  cc   cugugcug                  c
   uuuc      -c  -gc        uaagggcuaccgaagagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr3: 50084216-50084301 [-]
sense
ENSPTRT00000054432 ; ptr-mir-425-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-425
ptr-mir-191chr3: 50084686-50084776 [-]
ptr-mir-425chr3: 50084216-50084301 [-]
Database links

Mature sequence ptr-miR-425

Accession MIMAT0008144
Sequence

14 - 

aaugacacgaucacucccguuga

 - 36

Get sequence
Evidence by similarity; MI0001448
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).