Stem-loop sequence ptr-mir-653

AccessionMI0008840 (change log)
DescriptionPan troglodytes miR-653 stem-loop
Gene family MIPF0000435; mir-653
Stem-loop
   ----------u      cuu              u     c     cagcu 
5'            ucauuc   caguguugaaacaa cucua ugaac     u
              ||||||   |||||||||||||| ||||| |||||     c
3'            aguaag   guuauaacuuuguu gaggu acuug     a
   gaagguagaau      aac              u     c     aacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 96352356-96352450 [-]
sense
ENSPTRT00000054559 ; ptr-mir-653-201; exon 1
ENSPTRT00000044676 ; CALCR-201; intron 2
Clustered miRNAs
< 10kb from ptr-mir-653
ptr-mir-489chr7: 96353454-96353536 [-]
ptr-mir-653chr7: 96352356-96352450 [-]
Database links

Mature sequence ptr-miR-653

Accession MIMAT0008303
Sequence

13 - 

guguugaaacaaucucuacug

 - 33

Get sequence
Evidence by similarity; MI0003674

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).